Circular 200,100 with 8 bp bulge loops (GAPDH)
(Plasmid
#170121)
-
PurposeAAV vector carrying a guide RNA targeting the human GAPDH mRNA
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170121 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV
-
Backbone manufacturerCustom
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 6300
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCircular 200,100 guide RNA with 8bp bulge loops
-
gRNA/shRNA sequenceGCCATCAGTCGCCGGTCCCAAGCCCGGATAAAATGGGAGGGGGCGGGAAACCGCCTAACCATGCCGACTGATGGCAGAAAAAAAAAAAGGCCATCCACAGTCTTCTGGGTGGCAGTGATGGCATGGACTGTGGTCATGAGTCCTTCCACGATACGTTCGTTGTCATGGATGACCTTGGCCAGGGGTGCCAAGCACAACGTGGTGCAGGAGGCATTGCTGATGATCTTGAGGCTGTTGTCATACTTCTCATGGTTCACACCCATGACGAACATGGGGGCATCAGCAGAGAAAAAAAAAAAACTGCCATCAGTCGGCGTGGACTGTAGAACACTGCCAATGCCGGTCCCAAGCCCGGATAAAAGTGGAGGGTACAGTCCACGC
-
SpeciesH. sapiens (human)
-
Entrez GeneGAPDH (a.k.a. G3PD, GAPD, HEL-S-162eP)
- Promoter Human U6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Circular 200,100 with 8 bp bulge loops (GAPDH) was a gift from Prashant Mali (Addgene plasmid # 170121 ; http://n2t.net/addgene:170121 ; RRID:Addgene_170121) -
For your References section:
Efficient in vitro and in vivo RNA editing via recruitment of endogenous ADARs using circular guide RNAs. Katrekar D, Yen J, Xiang Y, Saha A, Meluzzi D, Savva Y, Mali P. Nat Biotechnol. 2022 Feb 10. pii: 10.1038/s41587-021-01171-4. doi: 10.1038/s41587-021-01171-4. 10.1038/s41587-021-01171-4 PubMed 35145312