pBZ210-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Ec86RT-NLS-T2A-mCherry
(Plasmid
#170185)
-
PurposeExpression vector for a sgRNA against BFP and spCas9-Ec86 RT fusion protein linked to mCherry via a T2A peptide. Donor template An was inserted in the Retron Ec86 msr-msd region by SpeI and AvrII.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 170185 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBZ191-pU6-sgBFP-CBh-sv40NLS-Cas9-NLS-T2A-mCherry
-
Backbone manufacturerFraser lab
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameEc86 RT
-
Alt nameRT-Sau1
-
SpeciesEscherichia coli
- Promoter CBh
-
Tag
/ Fusion Protein
- NLS (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer CACGATATGTCTAAGGCAAC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameRetron Ec86 msr-msd
-
Alt nameRetron Eco1 msr-msd
-
SpeciesEscherichia coli
- Promoter hU6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer acttgatgtactgccaagtg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameBFP-to-GFP conversion donor template An
- Promoter hU6
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer GACTATCATATGCTTACCGT
- 3′ sequencing primer acttgatgtactgccaagtg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBZ210-pU6-sgBFP-An_CBh-sv40NLS-Cas9-Ec86RT-NLS-T2A-mCherry was a gift from Hunter Fraser (Addgene plasmid # 170185 ; http://n2t.net/addgene:170185 ; RRID:Addgene_170185) -
For your References section:
Bacterial Retrons Enable Precise Gene Editing in Human Cells. Zhao B, Chen SA, Lee J, Fraser HB. CRISPR J. 2022 Jan 24. doi: 10.1089/crispr.2021.0065. 10.1089/crispr.2021.0065 PubMed 35076284