-
PurposePlasmid for expressing HIV-1 envelope glycoprotein
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 171061 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCAGGS
- Backbone size w/o insert (bp) 4718
- Total vector size (bp) 7289
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHIV-1 Env
-
Insert Size (bp)2571
- Promoter CAG
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTCGGCTTCTGGCGTGTGAC
- 3′ sequencing primer TCATGGCAGCCAGCATATGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAT001 was a gift from Jennifer Doudna (Addgene plasmid # 171061 ; http://n2t.net/addgene:171061 ; RRID:Addgene_171061) -
For your References section:
Targeted delivery of CRISPR-Cas9 and transgenes enables complex immune cell engineering. Hamilton JR, Tsuchida CA, Nguyen DN, Shy BR, McGarrigle ER, Sandoval Espinoza CR, Carr D, Blaeschke F, Marson A, Doudna JA. Cell Rep. 2021 Jun 1;35(9):109207. doi: 10.1016/j.celrep.2021.109207. 10.1016/j.celrep.2021.109207 PubMed 34077734
Map uploaded by the depositor.
