pPPC016.109
(Plasmid #171144)

• Purpose: Expression of J1-BBa_J23117-mRFP and J109 scRNA on pBBR1-GmR plasmid
• Depositing Lab: Jesse Zalatan
• Publication: Kiattisewee et al Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002.

Backbone

• Vector backbone: pBBR1-MCS5
• Backbone manufacturer: Kenneth M. Peterson
• Backbone size w/o insert (bp): 4768
• Total vector size (bp): 6261
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Medium Copy in P. putida
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: J109 scRNA
• Alt name: AGGTATCCTGCGGTGTCCTG
• Species: Synthetic
• Insert Size (bp): 525
• Promoter: BBa_J23119

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tttcccagtcacgacgttgt
• 3′ sequencing primer: tgaccatgattacgccaagc

Gene/Insert 2

• Gene/Insert name: J1-BBa_J23117-mRFP
• Species: Synthetic
• Insert Size (bp): 1073
• Promoter: J1-BBa_J23117

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggggagaggcggtttgcgta
• 3′ sequencing primer: cgtttgtgatggcttccatg

Resource Information

• Supplemental Documents:
  • pPPC016.109.gbk

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternative names: pCK057, pBBR1-GmR_J1-mRFP_J109