pPPC030.306
(Plasmid #171151)

• Purpose: Mevalonate production pathway with J306 scRNA on pBBR1-GmR plasmid
• Depositing Lab: Jesse Zalatan
• Publication: Kiattisewee et al Metab Eng. 2021 Apr 27. pii: S1096-7176(21)00063-X. doi: 10.1016/j.ymben.2021.04.002.

Backbone

• Vector backbone: pPPC020.306
• Backbone manufacturer: Jesse Zalatan
• Backbone size w/o insert (bp): 6261
• Total vector size (bp): 9179
• Vector type: Bacterial Expression, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Growth instructions: Medium Copy in P. putida
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: J306 scRNA
• Alt name: TTGTGTCCAGAACGCTCCGT
• Species: Synthetic
• Insert Size (bp): 525
• Promoter: BBa_J23119

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: tttcccagtcacgacgttgt
• 3′ sequencing primer: tgaccatgattacgccaagc

Gene/Insert 2

• Gene/Insert name: J3-BBa_J23117-mvaES
• Species: E. faecalis (mvaES)
• Insert Size (bp): 3991
• Promoter: J3-BBa_J23117

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: ggggagaggcggtttgcgta
• 3′ sequencing primer: cgtttgtgatggcttccatg

Resource Information

• Supplemental Documents:
  • pPPC030.306.gbk
• A portion of this plasmid was derived from a plasmid made by: Nigel Scrutton

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Alternative names: pCK162, pBBR1-GmR_J3-BBa_J23117-mvaES