Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLI_TNF
(Plasmid #171179)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171179 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLIX_403
  • Backbone manufacturer
    David Root
  • Backbone size w/o insert (bp) 7607
  • Total vector size (bp) 8309
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human TNF
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    702
  • GenBank ID
    NM_000594.4
  • Promoter tight TRE promoter
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer GTATGTCGAGGTAGGCGTGTACG
  • 3′ sequencing primer CTGCGTTTCCCGGAACCA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLI_TNF was a gift from Veit Hornung (Addgene plasmid # 171179 ; http://n2t.net/addgene:171179 ; RRID:Addgene_171179)
  • For your References section:

    C-tag TNF: a reporter system to study TNF shedding. Pinci F, Gaidt MM, Jung C, Kuut G, Jackson MA, Bauernfried S, Hornung V. J Biol Chem. 2020 Dec 25;295(52):18065-18075. doi: 10.1074/jbc.RA120.015248. Epub 2020 Oct 20. 10.1074/jbc.RA120.015248 PubMed 33082141