pYeDP60-hATP13A2-WT
(Plasmid #171377)

• Purpose: A modified pYEDP60 plasmid containing a yeast codon-optimized version of human ATP13A2 variant 2, followed by a thrombin cleavage site and a C-terminal BAD tag. DOI: 10.21769/BioProtoc.3888
• Depositing Lab: Peter Vangheluwe
• Publication: van Veen et al Nature. 2020 Feb;578(7795):419-424. doi: 10.1038/s41586-020-1968-7. Epub 2020 Jan 29.

Backbone

• Vector backbone: pYeDP60
• Backbone manufacturer: Joseph Lyons
• Backbone size w/o insert (bp): 9259
• Total vector size (bp): 13089
• Modifications to backbone: insert of hATP13A2, thrombin cleavage site, BAD tag
• Vector type: Yeast Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: human ATP13A2 variant 2 wild-type
• Alt name: hATP13A2
• Alt name: polyamine-transporting ATPase 13A2 isoform 2 [Homo sapiens]
• Species: H. sapiens (human)
• Insert Size (bp): 3830
• GenBank ID: NM_001141973.3
• Promoter: URA3
• Tag / Fusion Protein:
  • BAD tag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (unknown if destroyed)
• 3′ cloning site: ClaI (unknown if destroyed)
• 5′ sequencing primer: TAACTTGGCCCACGCTGAAA
• 3′ sequencing primer: CATGTTGGAATCTGTTCTTGATCAATGCCTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry