Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

141_pT3TS_iCre
(Plasmid #171793)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 171793 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEST-T3TS-R1-R3
  • Total vector size (bp) 4473
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    optimised Cre for RNA expression
  • Species
    Synthetic
  • Promoter T3

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer ACTGGCCGTCGTTTTACA
  • 3′ sequencing primer CAGGAAACAGCTATGACCATG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    141_pT3TS_iCre was a gift from Jean Giacomotto (Addgene plasmid # 171793 ; http://n2t.net/addgene:171793 ; RRID:Addgene_171793)
  • For your References section:

    Optimising the zebrafish Cre/Lox toolbox. Codon improved iCre, new gateway tools, Cre protein and guidelines. Tromp A, Wang H, Hall TE, Mowry B, Giacomotto J. Front Physiol. 2023 Aug 2;14:1221310. doi: 10.3389/fphys.2023.1221310. eCollection 2023. 10.3389/fphys.2023.1221310 PubMed 37601640