pTF101.1gw3
(Plasmid #172181)

• Purpose: A binary plasmid for gateway 3-Entry in pTF101.1 background (attR1 & attR2) containing double CaMV 35S promoter and TEV enhancer to drive bialophos resistance gene (bar) for plant transformation.
• Depositing Lab: Kan Wang
• Publication: Paz et al Plant Cell Rep. 2006 Mar;25(3):206-13. doi: 10.1007/s00299-005-0048-7. Epub 2005 Oct 25.

Backbone

• Vector backbone: pTF101.1
• Backbone manufacturer: Kan Wang
• Backbone size w/o insert (bp): 9189
• Total vector size (bp): 10979
• Modifications to backbone: attR3-CmR-ccdB-attR4 cassette was inserted for Gateway cloning.
• Vector type: Plant Expression
• Selectable markers: Basta

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DB3.1
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: attR3-CmR-ccdB-attR4
• Species: Synthetic
• Insert Size (bp): 1704
• Promoter: lacUV5 promoter

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: cggataacaatttcacacag
• 3′ sequencing primer: caggaaacagctatgaccat

Resource Information

• Supplemental Documents:
  • pTF101.1 gw3.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note that there are minor differences between the Addgene verified sequence and the depositor's reference sequence. These differences do not affect plasmid function.