pGLOW39
(Plasmid
#173068)
-
PurposemScarlet^SEC^3xMyc vector with ccdB sites for cloning homology arms
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173068 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19 (modified)
- Backbone size w/o insert (bp) 2661
- Total vector size (bp) 10468
-
Modifications to backboneAddition of ccdB markers to facilitate homology arm cloning
-
Vector typeWorm Expression, Cre/Lox, CRISPR
-
Selectable markersHygromycin ; sqt-1(d) (worm phenotypic marker)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)ccdB Survival
-
Growth instructionsThe dual ccdB sites in this vector may make it prone to recombination. It is recommended to pick several single clones and check test by restriction digestion before use. This construct should be maintained as a purified plasmid stock in addition to a bacterial stock in case there is a need to re-transform.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemScarlet-I-C1^SEC^3xMyc
-
SpeciesC. elegans (nematode), Synthetic
-
Insert Size (bp)6587
-
Tags
/ Fusion Proteins
- C. elegans codon-optimized mScarlet
- 3xMyc
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GTTTTCCCAGTCACGAC (M13 fwd)
- 3′ sequencing primer AGCGGATAACAATTTCACACAGGA (M13 rev) (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byDerived from pDD287 (Addgene #70685) and pMS050 (Addgene #91826)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
C. elegans codon-optimized mScarlet. pGLOW39 is a derivative of published TagRFP-SEC vectors (Dickinson et al. Genetics 2015). It has a 3xMyc tag in place of 3xFlag and Lox2272 sites in place of LoxP. These features allow pGLOW39 to be used in a genetic background that has already been modified using a green FP-SEC vector, without conflicts between epitope tags and Lox sites. Made by George Huang (Glow Worms '20).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGLOW39 was a gift from Ryan Doonan (Addgene plasmid # 173068 ; http://n2t.net/addgene:173068 ; RRID:Addgene_173068) -
For your References section:
mScarlet and split fluorophore mScarlet resources for plasmid-based CRISPR/Cas9 knock-in in C. elegans. Witten G, DeMott E, Huang G, Zelasko F, de Jesus B, Mulchand C, Schuck L, Pullman S, Perez A, Mahableshwarkar P, Wu Z, Cardona EA, Pierce JT, Dickinson DJ, Doonan R. MicroPubl Biol. 2023 Jun 14;2023:10.17912/micropub.biology.000871. doi: 10.17912/micropub.biology.000871. eCollection 2023. 10.17912/micropub.biology.000871 PubMed 37396790