pM162
(Plasmid #173221)

• Purpose: Expresses ScFV-GCN4-GFP10M2-GB1-T2A-OptGFP(1-9)-GB1 and Puro-T2A-MCP-mCherry-GFP11-GB1
• Depositing Lab: Hajin Kim
• Publication: Chaudhary et al Genome Res. 2020 Sep;30(9):1306-1316. doi: 10.1101/gr.260018.119. Epub 2020 Sep 4.

Backbone

• Vector backbone: pHAGE-DEST
• Backbone size w/o insert (bp): 6589
• Total vector size (bp): 11824
• Modifications to backbone: None
• Vector type: Mammalian Expression, Lentiviral, CRISPR
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: ScFV-GCN4-GFP10M2-GB1-T2A-OptGFP (1-10)-GB1
• Species: Synthetic
• Insert Size (bp): 2280
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: gatcgcctggagacgccatc

Gene/Insert 2

• Gene/Insert name: MCP-mCherry-GFP11-GB1
• Species: Synthetic
• Insert Size (bp): 2316
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: ggccgcgtggataaccgtattac
• 3′ sequencing primer: agttaagaataccagtcaatctttcac

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

All-in-one plasmid containing mCherry and Puromycin selection markers