Arp2/3_pBIG2abcd
(Plasmid
#173683)
-
PurposeInsect expression of the 7-subunit Human Arp2/3 complex
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBIG2abcd
- Backbone size w/o insert (bp) 5668
- Total vector size (bp) 16996
-
Vector typeInsect Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameArp2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1185
- Promoter polyhedrin
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer Arp2_seq_for: ATGGATTCGCAGGGCCG
- 3′ sequencing primer Arp2_seq_rev: TTATCTTACAGTAACACCGAGTTTTTCGAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameArp3
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1254
- Promoter polyhedrin
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer Arp3_seq_for: ATGGCGGGACGCTTGC
- 3′ sequencing primer Arp3_seq_rev: TTAGGACATGACGCCAAACACG (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameArpC2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)900
- Promoter polyhedrin
Cloning Information for Gene/Insert 3
- Cloning method Gibson Cloning
- 5′ sequencing primer -
- 3′ sequencing primer ArpC2_seq_rev: TTAGCGTGAGGAGAAAGTTTTGCC (Common Sequencing Primers)
Gene/Insert 4
-
Gene/Insert nameArpC3-FLAG
-
SpeciesH. sapiens (human)
-
Insert Size (bp)594
- Promoter polyhedrin
Cloning Information for Gene/Insert 4
- Cloning method Gibson Cloning
- 5′ sequencing primer ArpC3_seq_for: ATGCCCGCATACCACTCTTC (Common Sequencing Primers)
Gene/Insert 5
-
Gene/Insert nameArpC4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)504
- Promoter polyhedrin
Cloning Information for Gene/Insert 5
- Cloning method Gibson Cloning
- 5′ sequencing primer -
- 3′ sequencing primer ArpC4_seq_rev: TTAAAAATTTTTCAGGAACTCTTCGGCAAC (Common Sequencing Primers)
Gene/Insert 6
-
Gene/Insert nameArpC5
-
SpeciesH. sapiens (human)
-
Insert Size (bp)456
- Promoter polyhedrin
Cloning Information for Gene/Insert 6
- Cloning method Gibson Cloning
- 5′ sequencing primer ArpC5_seq_rev: TTATACGGTTTTTCTCGCAGTAAGAACG (Common Sequencing Primers)
Gene/Insert 7
-
Gene/Insert nameArpC1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1116
- Promoter polyhedrin
Cloning Information for Gene/Insert 7
- Cloning method Gibson Cloning
- 5′ sequencing primer -
- 3′ sequencing primer ArpC1_seq_rev: TTATTTAATTTTCAAATCTTTGAGGGCTGATTCG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Arp2/3_pBIG2abcd was a gift from Roberto Dominguez (Addgene plasmid # 173683 ; http://n2t.net/addgene:173683 ; RRID:Addgene_173683) -
For your References section:
Cryo-EM structure of NPF-bound human Arp2/3 complex and activation mechanism. Zimmet A, Van Eeuwen T, Boczkowska M, Rebowski G, Murakami K, Dominguez R. Sci Adv. 2020 Jun 5;6(23). pii: 6/23/eaaz7651. doi: 10.1126/sciadv.aaz7651. Print 2020 Jun. 10.1126/sciadv.aaz7651 PubMed 32917641