Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pUFlip-floxed2A-KalTA4-; gcry1:BFP -2
(Plasmid #173891)


Item Catalog # Description Quantity Price (USD)
Plasmid 173891 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone manufacturer
    Karl J. Clark
  • Backbone size w/o insert (bp) 2730
  • Total vector size (bp) 7495
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy


  • Gene/Insert name
    2A-KalTA4; gcry1: BFP
  • Alt name
    P2A-monomeric KalTA4 gamma crystallin 1: BFP
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer aaaagcaagaaagaaaactagagtgg
  • 3′ sequencing primer atggctcataacaccccttg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note PacCI sites have replaced the BfuAI sites within the initial versions of these vectors created by the Essner lab.

Please visit for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUFlip-floxed2A-KalTA4-; gcry1:BFP -2 was a gift from Jeffrey Essner (Addgene plasmid # 173891 ; ; RRID:Addgene_173891)
  • For your References section:

    Cre/lox regulated conditional rescue and inactivation with zebrafish UFlip alleles generated by CRISPR-Cas9 targeted integration. Liu F, Kambakam S, Almeida MP, Ming Z, Welker JM, Wierson WA, Schultz-Rogers LE, Ekker SC, Clark KJ, Essner JJ, McGrail M. Elife. 2022 Jun 17;11. pii: 71478. doi: 10.7554/eLife.71478. 10.7554/eLife.71478 PubMed 35713402