pCMV-Spike-VLP
(Plasmid
#173922)
-
PurposeExpresses virus-like particles based upon the original SARS-Cov-2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 173922 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Login to view industry pricing.
Backbone
-
Vector backbonepUC57-Kan
- Backbone size w/o insert (bp) 2539
- Total vector size (bp) 8996
-
Modifications to backboneEcoRV on both ends allows linearization. LoxP allows rapid knock-in after re-circularization.
-
Vector typeMammalian Expression, Bacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameSARS-2 Spike Protein
-
SpeciesH. sapiens (human), Synthetic; SARS-COV-2
-
Insert Size (bp)3819
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CMV
-
Tag
/ Fusion Protein
- no tags, native protein
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer CMV-f CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameSARS-Cov-2 E protein
-
SpeciesH. sapiens (human), Synthetic; SARS-COV-2
-
Insert Size (bp)228
-
Entrez GeneE (a.k.a. GU280_gp04)
- Promoter 22bp IRES
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer tgctttgcttgtacagtaagg (Common Sequencing Primers)
Gene/Insert 3
-
Gene/Insert nameSARS-Cov-2 M Protein
-
SpeciesH. sapiens (human), Synthetic; SARS-COV-2
-
Insert Size (bp)669
-
Entrez GeneM (a.k.a. GU280_gp05)
- Promoter IE2 Promoter/Enhancer from Mouse MCMV
Cloning Information for Gene/Insert 3
- Cloning method Unknown
- 5′ sequencing primer gattccaacggtactattacc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made bySynthetic DNA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV-Spike-VLP was a gift from Andreas Stuermer (Addgene plasmid # 173922 ; http://n2t.net/addgene:173922 ; RRID:Addgene_173922)