pJEC626
(Plasmid
#174367)
-
PurposeActivation domain for modular CRISPRa. AD-SYNZIP. Expresses alphaNTD from the E coli RNAP with a SYNZIP17 domain fused to the N terminus.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174367 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCloDF13
- Backbone size w/o insert (bp) 1925
- Total vector size (bp) 3250
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameAlpha N-terminal domain from the E. coli RNA polymerase fused to SYNZIP17
-
Alt nameRpoA
-
SpeciesSynthetic; E. coli
-
Insert Size (bp)903
- Promoter J23106
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer acagggcaaaagattacgc
- 3′ sequencing primer gtttattgactaccggaagcagtgtgac (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJEC626 was a gift from James Chappell (Addgene plasmid # 174367 ; http://n2t.net/addgene:174367 ; RRID:Addgene_174367) -
For your References section:
Rational engineering of a modular bacterial CRISPR-Cas activation platform with expanded target range. Villegas Kcam MC, Tsong AJ, Chappell J. Nucleic Acids Res. 2021 May 7;49(8):4793-4802. doi: 10.1093/nar/gkab211. 10.1093/nar/gkab211 PubMed 33823546