pDTFendoNA2
(Plasmid
#174731)
-
PurposeExpresses DT386F-endoNA2 fusion protein for selective elimination of polysialic acid–containing cells. Truncated diphtheria toxin fused to noncatalytic endosialidase via a furin-cleavable linker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 174731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFEndoNA2
-
Backbone manufacturerFinne lab
- Backbone size w/o insert (bp) 7102
- Total vector size (bp) 7546
-
Modifications to backboneThe egfp gene deleted, and NotI and SpeI restriction sites introduced
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDT386F
-
Alt nametox gene
-
SpeciesCorynebacterium diphtheriae
-
Insert Size (bp)1181
-
MutationDeleted amino acids 412-560 (the receptor binding domain R of diphtheria toxin) and added the furin protease cleavage motif RVRR.
-
GenBank IDNC_002935.2
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NotI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer CCCGAAAAGTGCCACCTG
- 3′ sequencing primer CGTGTACAGCTTATCTAACC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid can be amplified and maintained in ampicillin-sensitive E. coli strains that harbor the lacIq mutation (such as XL1 Blue and JM109) or carries the pREP4 repressor plasmid (such as M15 [pREP4]).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDTFendoNA2 was a gift from Jukka Finne (Addgene plasmid # 174731 ; http://n2t.net/addgene:174731 ; RRID:Addgene_174731) -
For your References section:
Design of a cytotoxic neuroblastoma-targeting agent using an enzyme acting on polysialic acid fused to a toxin. Lehti TA, Pajunen MI, Jokilammi A, Korja M, Lilie H, Vettenranta K, Finne J. Mol Cancer Ther. 2021 Jul 26. pii: 1535-7163.MCT-20-1031. doi: 10.1158/1535-7163.MCT-20-1031. 10.1158/1535-7163.MCT-20-1031 PubMed 34315766