HP-Cas9hGem-Ade2-LEU2-LINEAR
(Plasmid
#174839)
-
PurposepRS414 backbone containing LINEAR fragment targeting ADE2 in H. polymorpha
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 174839 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS414
- Total vector size (bp) 13049
-
Vector typeBacterial Expression, Yeast Expression, CRISPR, Synthetic Biology
-
Selectable markersTRP1, LEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHH-gRNA-HDV targetting ADE2 in Ogataea (para)polymorpha
-
SpeciesOgataea (para)polymorpha
-
Insert Size (bp)215
-
GenBank IDXM_014078618
- Promoter TDH3p
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GAACAGGGGCACAAACAGGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byA portion of this plasmid was derived from pUDP013 (Addgene #103873)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HP-Cas9hGem-Ade2-LEU2-LINEAR was a gift from Zengyi Shao (Addgene plasmid # 174839 ; http://n2t.net/addgene:174839 ; RRID:Addgene_174839) -
For your References section:
A repackaged CRISPR platform increases homology-directed repair for yeast engineering. Ploessl D, Zhao Y, Cao M, Ghosh S, Lopez C, Sayadi M, Chudalayandi S, Severin A, Huang L, Gustafson M, Shao Z. Nat Chem Biol. 2021 Oct 28. pii: 10.1038/s41589-021-00893-5. doi: 10.1038/s41589-021-00893-5. 10.1038/s41589-021-00893-5 PubMed 34711982
