10e8v4 scFv
(Plasmid
#175264)
-
PurposeExpression of 10e8v4 scFv in bacteria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 175264 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepET26b
-
Backbone manufacturerGenescript
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsDepositor recommends Origami cells for downstream applications.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name10e8v4 variable domain
-
Alt name10e8v4 scFv
-
SpeciesSynthetic
-
MutationNA
- Promoter T7
-
Tag
/ Fusion Protein
- his-tag (C terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
10e8v4 scFv was a gift from Randy Stockbridge (Addgene plasmid # 175264) -
For your References section:
N-terminal Transmembrane-Helix Epitope Tag for X-ray Crystallography and Electron Microscopy of Small Membrane Proteins. McIlwain BC, Erwin AL, Davis AR, Ben Koff B, Chang L, Bylund T, Chuang GY, Kwong PD, Ohi MD, Lai YT, Stockbridge RB. J Mol Biol. 2021 Aug 6;433(16):166909. doi: 10.1016/j.jmb.2021.166909. Epub 2021 Mar 5. 10.1016/j.jmb.2021.166909 PubMed 33676924