Skip to main content

10e8v4 scFv
(Plasmid #175264)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 175264 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pET26b
  • Backbone manufacturer
    Genescript
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Depositor recommends Origami cells for downstream applications.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    10e8v4 variable domain
  • Alt name
    10e8v4 scFv
  • Species
    Synthetic
  • Mutation
    NA
  • Promoter T7
  • Tag / Fusion Protein
    • his-tag (C terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    10e8v4 scFv was a gift from Randy Stockbridge (Addgene plasmid # 175264)
  • For your References section:

    N-terminal Transmembrane-Helix Epitope Tag for X-ray Crystallography and Electron Microscopy of Small Membrane Proteins. McIlwain BC, Erwin AL, Davis AR, Ben Koff B, Chang L, Bylund T, Chuang GY, Kwong PD, Ohi MD, Lai YT, Stockbridge RB. J Mol Biol. 2021 Aug 6;433(16):166909. doi: 10.1016/j.jmb.2021.166909. Epub 2021 Mar 5. 10.1016/j.jmb.2021.166909 PubMed 33676924