pX335-NQL003-WAPL-sgRNA2
(Plasmid
#175551)
-
PurposeFor transient expression of spCas9-nickase and one sgRNA targeting the mouse WAPL locus. Use together with pX335-NQL002-WAPL-sgRNA1 targeting construct.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 175551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepX335
-
Backbone manufacturerAddgene 42335
-
Vector typeMammalian Expression, Mouse Targeting
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsUse together with pX335-NQL002-WAPL-sgRNA1
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namespCas9-nickase and sgRNA against mouse WAPL STOP Codon
-
gRNA/shRNA sequenceTTACCTTTGCTTCAGGTGCT
-
SpeciesM. musculus (mouse)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pX335-NQL003-WAPL-sgRNA2 was a gift from Elzo de Wit (Addgene plasmid # 175551 ; http://n2t.net/addgene:175551 ; RRID:Addgene_175551) -
For your References section:
WAPL maintains a cohesin loading cycle to preserve cell-type-specific distal gene regulation. Liu NQ, Maresca M, van den Brand T, Braccioli L, Schijns MMGA, Teunissen H, Bruneau BG, Nora EP, de Wit E. Nat Genet. 2021 Jan;53(1):100-109. doi: 10.1038/s41588-020-00744-4. Epub 2020 Dec 14. 10.1038/s41588-020-00744-4 PubMed 33318687