Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSA10(gfcBCD)
(Plasmid #176193)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176193 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSA10
  • Backbone manufacturer
    from Dr Shoshi Altuvia
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    gfcBCD
  • Species
    E. coli E2348/69 O127:H6
  • Promoter Ptac

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer GCTCGTATAATGTGTGGAATTG
  • 3′ sequencing primer CGATGGTGTCAACGTAAATGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Insert is a contiguous set of genes gfcB, gfcC, gfcD. All 3 proteins are expressed with their native signal sequences

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSA10(gfcBCD) was a gift from Mark Saper (Addgene plasmid # 176193 ; http://n2t.net/addgene:176193 ; RRID:Addgene_176193)
  • For your References section:

    Escherichia coli O127 group 4 capsule proteins assemble at the outer membrane. Larson MR, Biddle K, Gorman A, Boutom S, Rosenshine I, Saper MA. PLoS One. 2021 Nov 15;16(11):e0259900. doi: 10.1371/journal.pone.0259900. eCollection 2021. 10.1371/journal.pone.0259900 PubMed 34780538