Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pUb LwaCas13a + LwaCas13a Guide RNA
(Plasmid #176307)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 176307 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pUb-3xFLAG-MCS
  • Total vector size (bp) 8665
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LwaCas13a
  • Mutation
    E656G, I1060V, D1076G- please see depositor comments
  • Promoter Ubi-p63e
  • Tag / Fusion Protein
    • HA tag (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer ATGACAATACAAACTAAGATTTAGTCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Depositor confirms E656G, I1060V, D1076G in LwaCas13a does not affect function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pUb LwaCas13a + LwaCas13a Guide RNA was a gift from Jeremy Wilusz (Addgene plasmid # 176307 ; http://n2t.net/addgene:176307 ; RRID:Addgene_176307)
  • For your References section:

    CRISPR/Cas13 effectors have differing extents of off-target effects that limit their utility in eukaryotic cells. Ai Y, Liang D, Wilusz JE. Nucleic Acids Res. 2022 Mar 4. pii: 6542487. doi: 10.1093/nar/gkac159. 10.1093/nar/gkac159 PubMed 35244715