pLenti-NG-PE2-BSD
(Plasmid #176933)

• Purpose: Expresses PE2-NG variant in mammalian cells
• Depositing Lab: Hyongbum Kim
• Publication: Jang et al Nat Biomed Eng. 2021 Aug 26. pii: 10.1038/s41551-021-00788-9. doi: 10.1038/s41551-021-00788-9.

Backbone

• Vector backbone: pLenti-PE2-BSD
• Total vector size (bp): 15147
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PE2-NG variant
• Species: Synthetic
• Insert Size (bp): 6273
• Promoter: EFS
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • SV40 NLS (C terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: acacaggaccggttctaga
• 3′ sequencing primer: tccaggattctcttcgacatct

Resource Information

• Supplemental Documents:
  • pLenti-NG-PE2-BSD.dna.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry