pRN3P_T3_BE3_IVT
(Plasmid #177015)

• Purpose: Plasmid to be used as DNA template for in-vitro RNA transcription of the BE3 base editor (C to T) by T3 RNA polymerase
• Depositing Lab: Timo Otonkoski
• Publication: Jalil et al Stem Cell Reports. 2021 Nov 16. pii: S2213-6711(21)00552-X. doi: 10.1016/j.stemcr.2021.10.017.

Backbone

• Vector backbone: pRN3P
• Backbone manufacturer: Torres-Padilla et al., 2007
• Backbone size w/o insert (bp): 3091
• Total vector size (bp): 8351
• Vector type: CRISPR ; Vector for in-vitro transcription

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Growth instructions: Grow solid and liquid cultures always at 30°C
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: BE3
• Alt name: Cytosine Base Editor
• Species: Synthetic
• Insert Size (bp): 5260
• Promoter: T3 promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamhI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: atgagctcagagactggcccag
• 3′ sequencing primer: ttagactttcctcttcttcttg

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry