Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pLenti PKAKTRn-Clover
(Plasmid #177200)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177200 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pLenti PGK Puro
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PKAKTRnew-mClover
  • Species
    Synthetic
  • Promoter PGK

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGTCGCCGTCCAGCTCGACCAG
  • 3′ sequencing primer CATGGTCCTGCTGGAGTTCGTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti PKAKTRn-Clover was a gift from Markus Covert (Addgene plasmid # 177200 ; http://n2t.net/addgene:177200 ; RRID:Addgene_177200)
  • For your References section:

    A multiplexed epitope barcoding strategy that enables dynamic cellular phenotypic screens. Kudo T, Lane K, Covert MW. Cell Syst. 2022 May 18;13(5):376-387.e8. doi: 10.1016/j.cels.2022.02.006. Epub 2022 Mar 21. 10.1016/j.cels.2022.02.006 PubMed 35316656