Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pEDJ333
(Plasmid #177272)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177272 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS415U
  • Backbone size w/o insert (bp) 6300
  • Total vector size (bp) 11000
  • Vector type
    Bacterial Expression, Yeast Expression
  • Selectable markers
    LEU2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    4146
  • Promoter GAL1

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sfa.AI (destroyed during cloning)
  • 3′ cloning site Sfa.AI (destroyed during cloning)
  • 5′ sequencing primer GAAGTGTCAACAACGTATCTACC
  • 3′ sequencing primer GTCTAACTCCTTCCTTTTCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEDJ333 was a gift from Michael Jensen (Addgene plasmid # 177272 ; http://n2t.net/addgene:177272 ; RRID:Addgene_177272)
  • For your References section:

    A synthetic RNA-mediated evolution system in yeast. Jensen ED, Laloux M, Lehka BJ, Pedersen LE, Jakociunas T, Jensen MK, Keasling JD. Nucleic Acids Res. 2021 Sep 7;49(15):e88. doi: 10.1093/nar/gkab472. 10.1093/nar/gkab472 PubMed 34107026