pEDJ333
(Plasmid
#177272)
-
PurposeGAL1p:Cas9:CYC1t
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 177272 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRS415U
- Backbone size w/o insert (bp) 6300
- Total vector size (bp) 11000
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas9
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)4146
- Promoter GAL1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sfa.AI (destroyed during cloning)
- 3′ cloning site Sfa.AI (destroyed during cloning)
- 5′ sequencing primer GAAGTGTCAACAACGTATCTACC
- 3′ sequencing primer GTCTAACTCCTTCCTTTTCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEDJ333 was a gift from Michael Jensen (Addgene plasmid # 177272 ; http://n2t.net/addgene:177272 ; RRID:Addgene_177272) -
For your References section:
A synthetic RNA-mediated evolution system in yeast. Jensen ED, Laloux M, Lehka BJ, Pedersen LE, Jakociunas T, Jensen MK, Keasling JD. Nucleic Acids Res. 2021 Sep 7;49(15):e88. doi: 10.1093/nar/gkab472. 10.1093/nar/gkab472 PubMed 34107026