Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJH3971
(Plasmid #177736)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 177736 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBSK
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GCaMP
  • Species
    Synthetic
  • Promoter Prgef-1
  • Tag / Fusion Protein
    • mNeptune (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XmaI (not destroyed)
  • 3′ cloning site AgeI (not destroyed)
  • 5′ sequencing primer TAGCGTCGACGGATCCAAAAA
  • 3′ sequencing primer GGAGGACGTGGAGGATCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJH3971 was a gift from Mei Zhen (Addgene plasmid # 177736 ; http://n2t.net/addgene:177736 ; RRID:Addgene_177736)
  • For your References section:

    Natural sensory context drives diverse brain-wide activity during C. elegans mating. Susoy V, Hung W, Witvliet D, Whitener JE, Wu M, Park CF, Graham BJ, Zhen M, Venkatachalam V, Samuel ADT. Cell. 2021 Sep 30;184(20):5122-5137.e17. doi: 10.1016/j.cell.2021.08.024. Epub 2021 Sep 16. 10.1016/j.cell.2021.08.024 PubMed 34534446