Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

XLone-BSD SPI1
(Plasmid #179514)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 179514 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Addgene # 96930
  • Backbone size w/o insert (bp) 5549
  • Total vector size (bp) 6419
  • Vector type
    Mammalian Expression, Synthetic Biology
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SPI1
  • Alt name
    OF
  • Alt name
    PU.1
  • Alt name
    SFPI1, SPI-1, SPI-A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    813
  • Entrez Gene
    SPI1 (a.k.a. AGM10, OF, PU.1, SFPI1, SPI-1, SPI-A)
  • Promoter TRE3GS Promoter

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site SpeI (not destroyed)
  • 5′ sequencing primer gcgcctataaaagagtgctga
  • 3′ sequencing primer cgcctgtcttaggttggagt
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Human SPI1 was cloned from Addgene plasmid #97039, a gift from George Daley Lab.

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    XLone-BSD SPI1 was a gift from Xiaoping Bao (Addgene plasmid # 179514 ; http://n2t.net/addgene:179514 ; RRID:Addgene_179514)
  • For your References section:

    Temporal Expression of Transcription Factor ID2 Improves Natural Killer Cell Differentiation from Human Pluripotent Stem Cells. Jung J, Chang Y, Jin G, Lian X, Bao X. ACS Synth Biol. 2022 May 24. doi: 10.1021/acssynbio.2c00017. 10.1021/acssynbio.2c00017 PubMed 35608547