GCN5 FL-dCas9-p300 core
(Plasmid
#179554)
-
Purposeencodes S. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human p300 core (aa 1048-1664) driven by EF-1alpha promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneLentiCRISPR v2
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameS. pyogenes dCas9 with n-terminal fusion of full length human GCN5 and c-terminal fusion of human p300 core (aa 1048-1664)
-
SpeciesH. sapiens (human)
-
Insert Size (bp)8565
-
MutationD10A; H840A in S.pyogenes Cas9
-
Entrez GeneEP300 (a.k.a. KAT3B, MKHK2, RSTS2, p300)
-
Entrez GeneKAT2A (a.k.a. GCN5, GCN5L2, PCAF-b, hGCN5)
- Promoter EF-1alpha
-
Tag
/ Fusion Protein
- Flag Tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer ATCCGGTGCCTAGAGAAGGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GCN5 FL-dCas9-p300 core was a gift from Isaac Hilton (Addgene plasmid # 179554 ; http://n2t.net/addgene:179554 ; RRID:Addgene_179554) -
For your References section:
Systematic comparison of CRISPR-based transcriptional activators uncovers gene-regulatory features of enhancer-promoter interactions. Wang K, Escobar M, Li J, Mahata B, Goell J, Shah S, Cluck M, Hilton IB. Nucleic Acids Res. 2022 Aug 12;50(14):7842-7855. doi: 10.1093/nar/gkac582. 10.1093/nar/gkac582 PubMed 35849129