1
Plasmid 17999: GFP-Bcl2
  • Bcl-2

  • Bcl2

  • 720

  • H. sapiens (human)

  • BCL2 (Bcl-2, PPP1R50)

  • GFP

  • N terminal on backbone

  • pEGFP-C1
    (Search Vector Database)

  • Clontech

  • Mammalian Expression

  • 4700

  • Bgl II

  • No

  • Eco RI

  • No

  • CATGGTCCTGCTGGAGTTCGT List of Sequencing Primers

  • Kanamycin

  • DH5alpha

  • 37

  • Unknown

  • Neomycin

  • human Bcl-2 was PCR amplified from pB4 plasmid purchased from ATCC

  • View sequences (1)
  • View map

  • Clark Distelhorst

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Transient expression of wild-type or mitochondrially targeted Bcl-2 induces apoptosis, whereas transient expression of endoplasmic reticulum-targeted Bcl-2 is protective against Bax-induced cell death. Wang et al (J Biol Chem. 2001 Nov 23. 276(47):44117-28. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 17999" in your Materials and Methods section.

Price: $65.00

Available to academic and non-profits only