1
Plasmid 18009: pWZL Hygro- TRF2
  • hTRF2

  • human TTAGGG repeat binding factor 2

  • 2455

  • 1497

  • H. sapiens (human)

  • TERF2 (TRBF2, TRF2)

  • aa2-500

  • pWZL Hygro
    (Search Vector Database)

  • Mammalian Expression, Retroviral

  • 5900

  • BamHI

  • No

  • EcoRI

  • No

  • CCTTTGTACACCCTAAGCCT List of Sequencing Primers

  • AATGCTCGTCAAGAAGAC

  • Ampicillin

  • DH5alpha

  • 37

  • High Copy

  • Hygromycin

  • View sequences (1)
  • View map

  • Titia de Lange

  • MTA

Addgene has sequenced a portion of this plasmid for verification. Click here for the sequencing result.

Article: Senescence induced by altered telomere state, not telomere loss. Karlseder et al (Science. 2002 Mar 29. 295(5564):2446-9. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 18009" in your Materials and Methods section.