Pb mD3S4-dN
(Plasmid
#180252)
-
PurposeP. berghei D3 (502-617) construct with N516T, S533N and N539Q mutations to abolish N-glycosylation was used for crystallization.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 180252 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepD2529CAG
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameD3 of P. berghei HAP2 with N-glycosylation sites mutated
-
SpeciesP. berghei
-
MutationN516T, S533N and N539Q
-
Tag
/ Fusion Protein
- 6His (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer TTTCCTACAGCTCCTGGGCAA
- 3′ sequencing primer TGCCACAGATGTTACTTAGCCTTT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Pb mD3S4-dN was a gift from Timothy Springer (Addgene plasmid # 180252 ; http://n2t.net/addgene:180252 ; RRID:Addgene_180252) -
For your References section:
Structural basis of malaria transmission blockade by a monoclonal antibody to gamete fusogen HAP2. Feng J, Dong X, DeCosta A, Su Y, Angrisano F, Sala KA, Blagborough AM, Lu C, Springer TA. Elife. 2021 Dec 23;10. pii: 74707. doi: 10.7554/eLife.74707. 10.7554/eLife.74707 PubMed 34939934