mitoZFD_ND2-Left-G1397-N
(Plasmid
#180770)
-
PurposeExpresses mitoZFD_ND2-Left-G1397-N(DddAtox half) in mammalian cells
-
Depositing Lab
-
Depositing OrganizationInstitute for Basic Science
Located in Republic of Korea -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 180770 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonep3s
- Backbone size w/o insert (bp) 5382
- Total vector size (bp) 6642
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemitoZFD for ND2 mutation
-
SpeciesSynthetic
-
Insert Size (bp)1260
- Promoter pCMV
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mitoZFD_ND2-Left-G1397-N was a gift from Jin-Soo Kim (Addgene plasmid # 180770 ; http://n2t.net/addgene:180770 ; RRID:Addgene_180770) -
For your References section:
Nuclear and mitochondrial DNA editing in human cells with zinc finger deaminases. Lim K, Cho SI, Kim JS. Nat Commun. 2022 Jan 18;13(1):366. doi: 10.1038/s41467-022-27962-0. 10.1038/s41467-022-27962-0 PubMed 35042880