pDY0973-RADARS iCaspase
(Plasmid
#182539)
-
PurposeExpress RADARS iCaspase that conditionally turn on iCaspase in the presence of target RNA
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 182539 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBR322
-
Backbone manufacturerNEB
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameiCaspase9
-
SpeciesH. sapiens (human)
-
GenBank IDNM_001229.5
- Promoter EF1a
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer caaagtttttttcttccatttcaggtgtcgtga
- 3′ sequencing primer gtaaaacgacggccagtgaattcgagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please visit https://doi.org/10.1101/2022.01.26.477951 for bioRxiv preprint.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDY0973-RADARS iCaspase was a gift from Omar Abudayyeh & Jonathan Gootenberg (Addgene plasmid # 182539 ; http://n2t.net/addgene:182539 ; RRID:Addgene_182539)