PX552-mScn8a-3xHA-Syn-smFP-flag
(Plasmid #182563)

• Purpose: For mouse Nav1.6 knockin with 3xHA at the C-terminal
• Depositing Lab: James Zhe Liu
• Publication: Liu et al J Neurosci. 2022 Jun 6;42(28):5482-98. doi: 10.1523/JNEUROSCI.0086-22.2022.

Backbone

• Vector backbone: PX552
• Vector type: AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: mouse Scn8a gRNA and 3xHA donor DNA
• Species: M. musculus (mouse)
• GenBank ID: NM_001077499.2
• Promoter: U6

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: TTCTTGGGTAGTTTGCAGTTTT

Gene/Insert 2

• Gene/Insert name: smFP-flag
• Insert Size (bp): 1014
• Promoter: EF1

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: CCTACCTAGACTCAGC
• 3′ sequencing primer: CCGCAGGCCCTACAGGTTG

Resource Information

• Supplemental Documents:
  • PX552-mScn8a-3xHA-Syn-smFP-flag.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry