CRISPR-psbA2 point mutation
(Plasmid
#182929)
-
Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 182929 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRSF1010
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert 1
-
Gene/Insert nameddcpf1
-
SpeciesFrancisella novicida
Gene/Insert 2
-
Gene/Insert namegRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
Gene/Insert 3
-
Gene/Insert namepsbA
-
SpeciesSynechococcus 7942
-
MutationS264A, and silent mutation to remove PAM site
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note: Plasmid contains a 105bp insertion in the backbone downstream of psbA1 compared to the depositor's provided sequence. This insertion is not known to affect plasmid function.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CRISPR-psbA2 point mutation was a gift from Himadri Pakrasi (Addgene plasmid # 182929 ; http://n2t.net/addgene:182929 ; RRID:Addgene_182929) -
For your References section:
Cpf1 Is A Versatile Tool for CRISPR Genome Editing Across Diverse Species of Cyanobacteria. Ungerer J, Pakrasi HB. Sci Rep. 2016 Dec 21;6:39681. doi: 10.1038/srep39681. 10.1038/srep39681 PubMed 28000776
Map uploaded by the depositor.
