1056F
(Plasmid
#183134)
-
PurposePlasmid supports expression of 2 gRNAs targeting D.suzukii tra, Opie-mVenus tagged, and can be integrated with pBac.
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183134 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBac
- Total vector size (bp) 10230
-
Vector typeInsect Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameU6.3-gRNAs[tra]
-
gRNA/shRNA sequenceACGGCTCCAGGTCGCGATCC CGCACATCGTCTGCAAAGTA
-
SpeciesD. melanogaster (fly); D.suzukii
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
1056F was a gift from Omar Akbari (Addgene plasmid # 183134 ; http://n2t.net/addgene:183134 ; RRID:Addgene_183134) -
For your References section:
Precision Guided Sterile Males Suppress Populations of an Invasive Crop Pest. Kandul NP, Liu J, Buchman A, Shriner IC, Corder RM, Warsinger-Pepe N, Yang T, Yadav AK, Scott MJ, Marshall JM, Akbari OS. GEN Biotechnology (2022) 1:4, 372-385 10.1089/genbio.2022.0019