Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

CROP_C9_Puro_MET
(Plasmid #183310)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 183310 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    CROPseq
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    MET
  • gRNA/shRNA sequence
    GCTAATCTTGGGACATCAGA
  • Species
    Synthetic

Cloning Information

  • Cloning method Gibson Cloning

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    CROP_C9_Puro_MET was a gift from Prashant Mali (Addgene plasmid # 183310 ; http://n2t.net/addgene:183310 ; RRID:Addgene_183310)
  • For your References section:

    Integrated genome and tissue engineering enables screening of cancer vulnerabilities in physiologically relevant perfusable ex vivo cultures. Hu M, Lei XY, Larson JD, McAlonis M, Ford K, McDonald D, Mach K, Rusert JM, Wechsler-Reya RJ, Mali P. Biomaterials. 2022 Jan;280:121276. doi: 10.1016/j.biomaterials.2021.121276. Epub 2021 Dec 2. 10.1016/j.biomaterials.2021.121276 PubMed 34890975