Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCAG-Dcst2-3xHA
(Plasmid #183543)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 183543 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAG1.1
  • Backbone size w/o insert (bp) 5259
  • Total vector size (bp) 7362
  • Modifications to backbone
    pCAGGS was used as an original vector. HA sequence was added.
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DC-STAMP domain containing 2
  • Alt name
    Dcst2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    2103
  • Entrez Gene
    Dcst2 (a.k.a. Gm760)
  • Tag / Fusion Protein
    • HA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XbaI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCCTTCTTCTTTTTCCTACAGC
  • 3′ sequencing primer GCCACACCAGCCACCACCTTCTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCAG-Dcst2-3xHA was a gift from Masahito Ikawa (Addgene plasmid # 183543 ; http://n2t.net/addgene:183543 ; RRID:Addgene_183543)
  • For your References section:

    Sperm membrane proteins DCST1 and DCST2 are required for sperm-egg interaction in mice and fish. Noda T, Blaha A, Fujihara Y, Gert KR, Emori C, Deneke VE, Oura S, Panser K, Lu Y, Berent S, Kodani M, Cabrera-Quio LE, Pauli A, Ikawa M. Commun Biol. 2022 Apr 7;5(1):332. doi: 10.1038/s42003-022-03289-w. 10.1038/s42003-022-03289-w PubMed 35393517