shRNA-Ratio-NegCon
(Plasmid
#183554)
-
PurposeDesigned to test the efficacy of shRNA by assessing the ratio of GFP-fusion protein to RFP (shRNA ratio negative control (Luciferase), Fig S2)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 183554 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneshRNA-Ratio
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLuciferase shRNA
-
gRNA/shRNA sequenceTAATATTCCAAAATGATATGAC
-
SpeciesOther
- Promoter CBh
Cloning Information
- Cloning method Gibson Cloning
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
shRNA-Ratio-NegCon was a gift from Erik Dent (Addgene plasmid # 183554 ; http://n2t.net/addgene:183554 ; RRID:Addgene_183554) -
For your References section:
A Single Transcript Knockdown-Replacement Strategy Employing 5' UTR Secondary Structures to Precisely Titrate Rescue Protein Translation. Millette MM, Holland ED, Tenpas TJ, Dent EW. Front Genome Ed. 2022 Mar 28;4:803375. doi: 10.3389/fgeed.2022.803375. eCollection 2022. 10.3389/fgeed.2022.803375 PubMed 35419562