Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

Akaby
(Bacterial strain #184224)

Full plasmid sequence is not available for this item.

No maps are available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Bacterial Strain 184224 Bacteria in agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    none

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 25 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    Akaby (NEB 5-alpha derivative)
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ∆RecB (RecB gene was replaced with a kanamycin resistant gene, KanR)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Colony PCR Primers:
(1) ATTTCTTCCATCAGGCGGT
(2) CAGTCATAGCCGAATAGCCT
(3) CGGTGCCCTGAATGAACTGC
(4) GTCCCTCTCCGGCATCATGA
Expected product size: 661bp with primer (1) and (2), 1035bp with primer (3) and (4).

Please visit https://www.biorxiv.org/content/10.1101/2021.11.03.467179v1 for bioRxiv preprint.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Akaby was a gift from Kate Adamala (Addgene plasmid # 184224)
  • For your References section:

    Akaby-Cell-free protein expression system for linear templates. Sato W, Sharon J, Deich C, Gaut N, Cash B, Engelhart AE, Adamala KP. PLoS One. 2022 Apr 7;17(4):e0266272. doi: 10.1371/journal.pone.0266272. eCollection 2022. 10.1371/journal.pone.0266272 PubMed 35390057