pMXs-hSTING-GFP
(Plasmid
#185442)
-
PurposeGFP-tagged human STING in a retroviral vector for stable expression
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 185442 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepMXs-IRES-Blasticidin Retroviral Vector
-
Backbone manufacturerCell BioLabs
- Backbone size w/o insert (bp) 5644
- Total vector size (bp) 7531
-
Vector typeRetroviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameStimulator of Interferon Genes
-
Alt nameSTING1, TMEM173
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1887
-
Entrez GeneSTING1 (a.k.a. ERIS, MITA, MPYS, NET23, SAVI, STING, STING-beta, TMEM173, hMITA, hSTING)
-
Tag
/ Fusion Protein
- GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer CATCGCAGCTTGGATACACGCC
- 3′ sequencing primer EGFP-C-REV
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byOriginal STING1 insert obtained from Plasmid #124262
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-hSTING-GFP was a gift from Pietro De Camilli (Addgene plasmid # 185442)