Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

fluoPEER-HEK3_5bp-del
(Plasmid #185476)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 185476 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pmGFP-P2A-K0-P2A-RFP
  • Backbone manufacturer
    Ramanujan Hegde
  • Backbone size w/o insert (bp) 5964
  • Total vector size (bp) 5999
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HEK3 editing site
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    59
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site Acc65I (not destroyed)
  • 5′ sequencing primer atgtggcgattctacacagaag
  • 3′ sequencing primer ttggtcaccttcagcttgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The reporter can be used in combination with pegRNA-HEK3_del1-5-NGG with any type of prime editor, which will also edit the HEK3 locus on the human genome. Editing on the reporter will result in mCherry fluorescence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    fluoPEER-HEK3_5bp-del was a gift from Sabine Fuchs (Addgene plasmid # 185476 ; http://n2t.net/addgene:185476 ; RRID:Addgene_185476)
  • For your References section:

    Mutation-specific reporter for optimization and enrichment of prime editing. Schene IF, Joore IP, Baijens JHL, Stevelink R, Kok G, Shehata S, Ilcken EF, Nieuwenhuis ECM, Bolhuis DP, van Rees RCM, Spelier SA, van der Doef HPJ, Beekman JM, Houwen RHJ, Nieuwenhuis EES, Fuchs SA. Nat Commun. 2022 Mar 1;13(1):1028. doi: 10.1038/s41467-022-28656-3. 10.1038/s41467-022-28656-3 PubMed 35232966