Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pNB_EA_3EGFP
(Plasmid #185967)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 185967 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Pz
  • Backbone manufacturer
    expressys.
  • Backbone size w/o insert (bp) 1900
  • Total vector size (bp) 3085
  • Modifications to backbone
    Insertion of Pr egfp cassette in forward direction in network brick
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Pr-Egfp cassette in forward direction in Network Brick
  • Species
    Synthetic
  • Insert Size (bp)
    1102
  • Promoter PR

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AatII (not destroyed)
  • 3′ cloning site PciI (not destroyed)
  • 5′ sequencing primer TACTGGGACGAAGACGAACA
  • 3′ sequencing primer GTTGTTTTGGAGCACGGAAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pNB_EA_3EGFP was a gift from Sangram Bagh (Addgene plasmid # 185967 ; http://n2t.net/addgene:185967 ; RRID:Addgene_185967)
  • For your References section:

    Processing two environmental chemical signals with a synthetic genetic IMPLY gate, a 2-input-2-output integrated logic circuit, and a process pipeline to optimize its systems chemistry in Escherichia coli. Mukhopadhyay S, Sarkar K, Srivastava R, Pal A, Bagh S. Biotechnol Bioeng. 2020 May;117(5):1502-1512. doi: 10.1002/bit.27286. Epub 2020 Feb 7. 10.1002/bit.27286 PubMed 31981217