pBXNPHM3-Nb_MsbA#1
(Plasmid
#186428)
-
PurposePlasmid for bacterial expression of MsbA binding Nanobody Nb_MsbA#1
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186428 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBXNPHM3
- Backbone size w/o insert (bp) 5311
- Total vector size (bp) 5662
-
Vector typeAffinity Reagent/ Antibody
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNanobody Nb_MsbA#1
-
SpeciesVicugna pacos
-
Insert Size (bp)351
- Promoter pBAD
-
Tags
/ Fusion Proteins
- PelB leader sequence (N terminal on backbone)
- His Tag (N terminal on backbone)
- Maltose Binding Protein (N terminal on backbone)
- 3C cleavage site (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BspQI (not destroyed)
- 3′ cloning site BspQI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer GATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBXNPHM3-Nb_MsbA#1 was a gift from Markus Seeger (Addgene plasmid # 186428 ; http://n2t.net/addgene:186428 ; RRID:Addgene_186428) -
For your References section:
The ABC transporter MsbA adopts the wide inward-open conformation in E. coli cells. Galazzo L, Meier G, Januliene D, Parey K, De Vecchis D, Striednig B, Hilbi H, Schafer LV, Kuprov I, Moeller A, Bordignon E, Seeger MA. Sci Adv. 2022 Oct 14;8(41):eabn6845. doi: 10.1126/sciadv.abn6845. Epub 2022 Oct 12. 10.1126/sciadv.abn6845 PubMed 36223470