pGL3-Camk2b
(Plasmid
#186819)
-
PurposeFluorescent reporter for Camk2b expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 186819 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGL3-Basic
-
Backbone manufacturerPromega
- Backbone size w/o insert (bp) 4818
- Total vector size (bp) 5892
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCamk2b promoter
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1089
-
Entrez GeneCamk2b (a.k.a. CaMKII)
- Promoter Camk2b promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer CTTACGCGTATCCAGAAGATCGCCGAACAG
- 3′ sequencing primer GCGAGATCTGCTCGCTCTGTCCCC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGL3-Camk2b was a gift from Hung-Chun Chang (Addgene plasmid # 186819 ; http://n2t.net/addgene:186819 ; RRID:Addgene_186819) -
For your References section:
ISX-9 potentiates CaMKIIdelta-mediated BMAL1 activation to enhance circadian amplitude. Li H, Ou J, Li Y, Xu N, Li Q, Wu P, Peng C, Tang YC, Chang HC. Commun Biol. 2022 Jul 28;5(1):750. doi: 10.1038/s42003-022-03725-x. 10.1038/s42003-022-03725-x PubMed 35902736