Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at Learn more

pRS416 Gal-RNQ1-YFP
(Plasmid #18685)

Full plasmid sequence is not available for this item.


Item Catalog # Description Quantity Price (USD)
Plasmid 18685 Plasmid sent as bacteria in agar stab 1 $65 Add to Cart
Available to Academic and Nonprofits Only


  • Vector backbone
    pRS416 Gal
  • Backbone size w/o insert (bp) 6267
  • Vector type
    Yeast Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    Low Copy


  • Gene/Insert name
  • Alt name
    Rnq1 YFP
  • Alt name
    Gal-Rnq1-YFP p416
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
  • Entrez Gene
    RNQ1 (a.k.a. YCL028W)
  • Tag / Fusion Protein
    • YFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer From Gal Promoter GTTAATATACCTCTATACTTTAACGTCAAGGAGA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS416 Gal-RNQ1-YFP was a gift from Susan Lindquist (Addgene plasmid # 18685)
  • For your References section:

    Chaperone-dependent amyloid assembly protects cells from prion toxicity. Douglas PM, Treusch S, Ren HY, Halfmann R, Duennwald ML, Lindquist S, Cyr DM. Proc Natl Acad Sci U S A. 2008 May 20. 105(20):7206-11. 10.1073/pnas.0802593105 PubMed 18480252