pRS416 Gal-RNQ1-YFP
(Plasmid #18685)

Available to Academic and Nonprofits Only

Backbone

  • Vector backbone
    pRS416 Gal
  • Backbone size w/o insert (bp) 6267
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Sequence Information

Full plasmid sequence is available only if provided by the depositing laboratory.

Gene/Insert

  • Gene/Insert name
    Rnq1
  • Alt name
    Rnq1 YFP
  • Alt name
    Gal-Rnq1-YFP p416
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1215
  • Entrez Gene
    RNQ1 (a.k.a. YCL028W)
  • Tag / Fusion Protein
    • YFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer From Gal Promoter GTTAATATACCTCTATACTTTAACGTCAAGGAGA
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS416 Gal-RNQ1-YFP was a gift from Susan Lindquist (Addgene plasmid # 18685)
  • For your References section:

    Chaperone-dependent amyloid assembly protects cells from prion toxicity. Douglas PM, Treusch S, Ren HY, Halfmann R, Duennwald ML, Lindquist S, Cyr DM. Proc Natl Acad Sci U S A. 2008 May 20. 105(20):7206-11. 10.1073/pnas.0802593105 PubMed 18480252