Plasmid 18685: pRS416 Gal-RNQ1-YFP
  • Rnq1

  • Rnq1 YFP

  • Gal-Rnq1-YFP p416

  • 1215

  • S. cerevisiae (budding yeast)

  • RNQ1 (YCL028W)

  • YFP

  • C terminal on backbone

  • pRS416 Gal
    (Search Vector Database)

  • Yeast Expression

  • 6267

  • Xba1

  • No

  • BamH1

  • No

  • From Gal Promoter GTTAATATACCTCTATACTTTAACGTCAAGGAGA List of Sequencing Primers

  • Ampicillin

  • DH5alpha

  • 37

  • Low Copy

  • URA3

  • View sequences (1)
  • View map

  • Susan Lindquist

    Ancillary Agreement for Plasmids Containing FP Materials

Addgene has sequenced a portion of this plasmid for verification. Full plasmid sequence is available only if provided by the depositing laboratory.

Article: Chaperone-dependent amyloid assembly protects cells from prion toxicity. Douglas et al (Proc Natl Acad Sci U S A. 2008 May 20. 105(20):7206-11. PubMed)

Please acknowledge the principal investigator and cite this article if you use this plasmid in a publication. Also, please include the text "Addgene plasmid 18685" in your Materials and Methods section.

Price: US $65

Available to academic and non-profits only
This is commonly requested with
1174: RMC sup35 promotor
18684: pRS416 Gal-RNQ1