Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pRS416 Gal-RNQ1 L94A-YFP
(Plasmid #18692)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 18692 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS416 Gal
  • Backbone size w/o insert (bp) 6268
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Rnq1 L94A
  • Alt name
    Rnq1 L94A-YFP
  • Alt name
    Gal-Rnq1 L94A-YFP p416
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1215
  • Mutation
    Leucine 94 mutated to Alanine (L94A)
  • Entrez Gene
    RNQ1 (a.k.a. YCL028W)
  • Tag / Fusion Protein
    • YFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xba1 (not destroyed)
  • 3′ cloning site BamH1 (not destroyed)
  • 5′ sequencing primer From Gal Promoter GTTAATATACCTCTATACTTTAACGTCAAGGAGA
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS416 Gal-RNQ1 L94A-YFP was a gift from Susan Lindquist (Addgene plasmid # 18692 ; http://n2t.net/addgene:18692 ; RRID:Addgene_18692)
  • For your References section:

    Chaperone-dependent amyloid assembly protects cells from prion toxicity. Douglas PM, Treusch S, Ren HY, Halfmann R, Duennwald ML, Lindquist S, Cyr DM. Proc Natl Acad Sci U S A. 2008 May 20. 105(20):7206-11. 10.1073/pnas.0802593105 PubMed 18480252