pLenti‐puro‐OgRNA_mdxE53
(Plasmid
#187054)
-
PurposeSpCas9 gRNA correcting mdx4cv nonsense mutation with ABE
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187054 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLenti
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSpCas9 gRNA correcting mdx4cv nonsense mutation with ABE
-
gRNA/shRNA sequenceGTTATCTCCTGTTCTGCAGC
-
SpeciesSynthetic
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer AGGGCCTATTTCCCATGATTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti‐puro‐OgRNA_mdxE53 was a gift from Renzhi Han (Addgene plasmid # 187054 ; http://n2t.net/addgene:187054 ; RRID:Addgene_187054) -
For your References section:
Efficient precise in vivo base editing in adult dystrophic mice. Xu L, Zhang C, Li H, Wang P, Gao Y, Mokadam NA, Ma J, Arnold WD, Han R. Nat Commun. 2021 Jun 17;12(1):3719. doi: 10.1038/s41467-021-23996-y. 10.1038/s41467-021-23996-y PubMed 34140489