PLL5.0-Anillin ShRNA-Cherry-AnillinFL
(Plasmid
#187271)
-
PurposeLentiviral expression of shRNA targeting Anillin + reconstitution of Anillin full length
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 187271 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLL5.0
- Backbone size w/o insert (bp) 7590
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAnillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra)
-
gRNA/shRNA sequenceTCGGCGATGCCTCTTTGAATAAATTCAAGAGATTTATTCAAAGAGGCATCGCCATTTTTT
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3324
-
Entrez GeneANLN (a.k.a. FSGS8, Scraps, scra)
- Promoter U6, CMV
-
Tag
/ Fusion Protein
- mCherry (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer mU6 Forward Primer, mCherry-F
- 3′ sequencing primer WPRE-R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byPlasmid made by Srikanth Budnar
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Rescue with reconstituted FL Anillin.
5' cloning site: SacII (not destroyed), 3' cloning site: Sbf1 (destroyed).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
PLL5.0-Anillin ShRNA-Cherry-AnillinFL was a gift from Alpha Yap (Addgene plasmid # 187271 ; http://n2t.net/addgene:187271 ; RRID:Addgene_187271) -
For your References section:
Anillin Promotes Cell Contractility by Cyclic Resetting of RhoA Residence Kinetics. Budnar S, Husain KB, Gomez GA, Naghibosadat M, Varma A, Verma S, Hamilton NA, Morris RG, Yap AS. Dev Cell. 2019 Jun 17;49(6):894-906.e12. doi: 10.1016/j.devcel.2019.04.031. Epub 2019 May 16. 10.1016/j.devcel.2019.04.031 PubMed 31105010