PLL5.0-Anillin ShRNA-GFP-AnillinA740D, E758K
(Plasmid #187274)

• Purpose: Lentiviral expression of shRNA targeting Anillin + reconstitution of Anillin A740D,E758K
• Depositing Lab: Alpha Yap
• Publication: Budnar et al Dev Cell. 2019 Jun 17;49(6):894-906.e12. doi: 10.1016/j.devcel.2019.04.031. Epub 2019 May 16.

Backbone

• Vector backbone: pLL5.0
• Backbone size w/o insert (bp): 7574
• Vector type: Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Anillin ,hsAnillin, Entrez Gene ANLN (a.k.a. FSGS8, Scraps, scra)
• gRNA/shRNA sequence: TCGGCGATGCCTCTTTGAATAAATTCAAGAGATTTATTCAAAGAGGCATCGCCATTTTTT
• Species: H. sapiens (human)
• Insert Size (bp): 3324
• Mutation: Anillin A740D, E758K
• Entrez Gene: ANLN (a.k.a. FSGS8, Scraps, scra)
• Promoter: U6, 5'LTR
• Tag / Fusion Protein:
  • EGFP (N terminal on insert)

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: mU6 Forward Primer, EGFP forward primer
• 3′ sequencing primer: WPRE-R

Resource Information

• Supplemental Documents:
  • PLL5.0-Anillin ShRNA-GFP-AnillinA740D, E758K.gb
• A portion of this plasmid was derived from a plasmid made by: Plasmid made by Srikanth Budnar

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Rescue with reconstituted -Anillin A740D,E758K.

5' cloning site: SacII (destroyed), 3' cloning site: Sbf1 (not destroyed).

With regard to all the Anillin sequences, I chose to number these residues as per the canonical sequence which is the full-length isoform. We have been using a smaller isoform, that lacks aa 508-544 as compared to the canonical isoform. The article that identified the Rho binding region on Anillin (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4449299/) followed the residue numbers of the canonical isoform to describe the mutations a740D, E758K (ref figure 2 in the article). Therefore, I chose to follow similar nomenclature when I generated the AHPH-DM for Rashmi's NCB paper. To harmonize the nomenclature across constructs, I continued to number the residues in all the GFP/Cherry Anillin constructs as per the canonical sequence.